| Primary Identifier | MGI:5804021 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dock9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dock9-7743J-F670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATAGCAGAGTATGACAC, TTGTCTGCTGGCCGTGTGGG, GCTGAACTTTTATGTCTCTA and AACCAGTGAAACACGACCCT, which resulted in a 439 bp deletion beginning at Chromosome 14 negative strand position 121,662,767 bp, GTCGTGTTTCACTGGTTCAG, and ending after GACCCAGTGTCATACTCTGC at 121,662,329 bp GRCm38/mm10). This mutation deletes exon 4 and 356 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp insertion (TAACTCGG) at the deletion site, which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 111 and early truncation 6 amino acids later. |
