|  Help  |  About  |  Contact Us

Allele : Ahsa1<em1(IMPC)J> AHA1, activator of heat shock protein ATPase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5804023 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ahsa1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ahsa1-8007J-M4644 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACTTTTAGGAATCCAAA, GGTGACTGCAAGGTTAAAGG, GGATCAGAGCTATGGCAACG and AGCGGCATTGGGCACTCAGT, which resulted in a 428 bp deletion beginning at Chromosome 12 positive strand position 87,268,069 bp, CTCCTTTAACCTTGCAGTCA, and ending after TGGGCACTCAGTGGGACGC at 87,268,496 bp (GRCm38/mm10). This mutation deletes exon 2 and 237 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTTTGGATTC) 62 bp 5-prime of the 428 bp deletion that will not alter the results of the large deletion. This mutation is predicted to cause a change of amino acid sequence after residue 27 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ahsa1<em1J>,
  • Ahsa1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele