Primary Identifier | MGI:5795760 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Tbc1d31 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project Tbc1d31-7960J-M8930 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGTCACAAACTTTACAG, GAAATGGCTGTATTAGTATC, AGCTTCAGAAGGCAAACAGG and CTGAGGCAACACAGACTGGG, which resulted in a 170 bp deletion beginning at Chromosome 15 negative strand position 57,920,067 bp GCAAACAGGAGGACTTCTTA, and ending after GCTGTATTAGTATCAGGAAG at 57,919,898 bp (GRCm38/mm10). This mutation deletes exon 3 and 54 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp deletion (GACTGGGAC) 43 bp before the 170 bp deletion and a 31 bp deletion (CAGTGGTGGAGTTCTCAGAGGGGAAAAGGAG) 22 bp after the 170 bp deletion, which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 74 and early truncation 6 amino acids later. |