|  Help  |  About  |  Contact Us

Allele : Slc44a2<em1(IMPC)J> solute carrier family 44, member 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5796295 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc44a2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Slc44a2-7954J-F6530 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGAAGAAGCTGGAGAGCCG, TGTGTCTGCATGCTACCAAC, TTTGCCGGAGAACACACACT and CACATCCCTCGTGGGGAAGA, which resulted in a 231 bp deletion beginning at Chromosome 9 positive strand position 21,338,315 bp TGTAGTCCCCTGTTGGTAGC, and ending after TGGGGAGATGTGTCCCAGTG at 21,338,545 bp (GRCm38/mm10). This mutation deletes exon 2 and 182 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion (A) at the site of the deletion that will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 13 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Slc44a2<em1J>,
  • Slc44a2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele