| Primary Identifier | MGI:5803878 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Iqsec2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Iqsec2-RI-8041J-M4925 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTGAGTGAATGAACCGTGT, TCTAGTGTACTCACTCAGTT, GGTTGGGGTGTGGCTCTTGA and AGATGGCTCTGGTTGAAAAA, which resulted in a 519 bp deletion beginning at Chromosome X positive strand position 152,202,730 bp, GAACCGTGTAGGCAGTGAAG, and ending after GTTGGGGTGTGGCTCTTGAG at 152,203,248 bp (GRCm38/mm10). This mutation deletes exon 3 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 245 and early truncation 13 amino acids later. |
