| Primary Identifier | MGI:5804132 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ctbs |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ctbs-8029J-M7923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCTAATCTGCTTTCCAAG, CATTATGCTCTCTTTGGGAG, TTACTGTTATTTAAGGTCCT and ACATCTTAGTTTTATAGCAA, which resulted in a 517 bp deletion beginning at Chromosome 3 positive strand position 146,454,800 bp, CTTGGAAAGCAGATTAGAGG, and ending after TGTTACTGTTATTTAAGGTC at 146,455,316 bp (GRCm38/mm10). This mutation deletes exon 3 and 308 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 2 amino acids later. |