|  Help  |  About  |  Contact Us

Allele : Ccdc59<em1(IMPC)J> coiled-coil domain containing 59; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5804139 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc59
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ccdc59-8014J-F4739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, AATGTTTTACTGACGACACA and TGAGGAATTTCTGAAGACGG, which resulted in a 495 bp deletion beginning at Chromosome 10 positive strand position 105,842,368 bp, CTTATATTTAGGTAAAGGGC, and ending after AGGAAGGTAAGCACCTCCGT at 105,842,862 bp (GRCm38/mm10). This mutation deletes exon 2 and 188 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ccdc59<->,
  • Ccdc59<->,
  • Ccdc59<em1J>,
  • Ccdc59<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele