| Primary Identifier | MGI:5805216 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp2b3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Atp2b3-8009J-F4670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATGACTCTATGGAACAAG, GTCCAGTCAGGGCCTTTGCA, TTACTAATACATCCTAGCAG and TGGGCATCTTAGGTGTAGAG, which resulted in a 464 bp deletion beginning at Chromosome X positive strand position 73,536,041 bp, AAGGCCCTGACTGGACTCAG, and ending after ACTTTACTAATACATCCTAG at 73,536,504 bp (GRCm38/mm10). This mutation deletes exon 9 and 249 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GTT) 50 bp 5-prime of the 464 bp deletion which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 374 and early truncation 5 amino acids later. |
