|  Help  |  About  |  Contact Us

Allele : Cep135<em1(IMPC)J> centrosomal protein 135; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5805217 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cep135
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Cep135-8015J-M4780 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTCTTTCAGGGTATCAAA, GGCCTGTTTTGAGAAACTTG, CTAACCACAGTTCTATTCAT and CCTAAAAACCAAAGAGGGCA, which resulted in a 383 bp deletion beginning at Chromosome 5 positive strand position 76,593,055 bp, TTTGAGAAACTTGAGGACCCT, and ending after TAATGAAGGCTCCTTGCCCTC at 76,593,437 bp (GRCm38/mm10). This mutation deletes exon 2 and 192 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 4 bp deletion (GAAT) 88 bp 3-prime of the 383 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cep135<em1J>,
  • Cep135<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele