|  Help  |  About  |  Contact Us

Allele : Tmem87b<em1(IMPC)J> transmembrane protein 87B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5805532 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem87b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tmem87b-7963J-F1351 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAGTGATTTAGAGAAATT, CATTAAATTTTAACAGCTAC, CGTGTGTACAAAGCTGTGAA and CCAGCTGAGTAGGCTACAAG, which resulted in a 258 bp deletion beginning at Chromosome 2 positive strand position 128,824,346 bp, CAGCATTCTTGAAGCTTCAA, and ending after CTGAGTAGGCTACAAGTGGA at 128,824,603 bp (GRCm38/mm10). This mutation deletes exon 3 and 163 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7bp (TGCGTGT) insertion at the site of the 258 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 75 and early truncation 6 amino acids later.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Tmem87b<em1J>,
  • Tmem87b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele