| Primary Identifier | MGI:5812907 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdc42bpb |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cdc42bpb-8192J-M1439 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACATATTACGCATGCGGGA, TACCGGCTCCTTACATCTGG, TACTTTCCTGGTTAGATCCG and GCATATTGCTGGGCTTTGGA, which resulted in a 589 bp deletion beginning at Chromosome 12 negative strand position 111,345,857 bp CTTCCAAAGCCCAGCAATAT, and ending after TTTCCCCCCCTCCCGCATGC at 111,345,269 bp (GRCm38/mm10). This mutation deletes exon 2 and 497 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 9 amino acids later. |
