| Primary Identifier | MGI:5816118 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tecpr2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tecpr2-8162J-M2459 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGTCAACAACGGCTCAG, GGCAGGTCAACAACGGCTCA, ATCTGGCTAATAGGAAACCT and GGCTACCAGGAACTCCAGGC, which resulted in a 287 bp deletion beginning at Chromosome 12 positive strand position 110,918,838 bp, GAGCCGTTGTTGACCTGCCT and ending after ACCACAGCCACACCAGCCTG at 110,919,124 bp (GRCm38/mm10). This mutation deletes exon 5 and 129 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 160 and early truncation 13 amino acids later. |
