| Primary Identifier | MGI:5816145 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp92 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp92-8178J-M8966 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCTCTAAGATTCATGCAG, GTTTTCATTTCGGATTACCC, TTATCTTACCTATAACTTGT and GTGCGGAAAATGGGTCTGAC, which resulted in a 518 bp deletion beginning at Chromosome X positive strand position 73,419,955 bp, TTTCCACTGCATGAATCTTA, and ending after ATAACAACCTGTCAGACCCAT at 73,420,472 bp (GRCm38/mm10). This mutation deletes exon 4 and 391 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 37 amino acids later. |
