| Primary Identifier | MGI:5816161 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Agfg2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Agfg2-8101J-F2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAAAAGAAACTTTTGGG, CTCAAAGCTTTGCTACCAAG, GCTGTGGCAGGTGAGTGCAC and CACAGAAGATGGTCTCAGTC, which resulted in a 562 bp deletion beginning at Chromosome 5 negative strand position 137,668,182 bp, GCAGGGCTCTACCACTGAGC, and ending after CATGCCACTTGGTAGCAAAG at 137,667,621 bp (GRCm38/mm10). This mutation deletes exon 2 and 468 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 14 amino acids later. |
