|  Help  |  About  |  Contact Us

Allele : Sdr42e1<em1(IMPC)J> short chain dehydrogenase/reductase family 42E, member 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5817201 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sdr42e1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Sdr42e1-7839J-F8886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TAGGCCACTGGTCGAGGGCC and GTCGCCTCTTACGGCATGTC, which resulted in a 604 bp deletion beginning at Chromosome 8 negative strand position 117,663,658 bp CTCTTACGGCATGTCTGGGA and ending after ACACATTCCCATCCACCCGC at 117,663,055 bp (GRCm38/mm10). This mutation deletes 604 bp of exon 3 and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sdr42e1<em1J>,
  • Sdr42e1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele