| Primary Identifier | MGI:5817201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sdr42e1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sdr42e1-7839J-F8886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TAGGCCACTGGTCGAGGGCC and GTCGCCTCTTACGGCATGTC, which resulted in a 604 bp deletion beginning at Chromosome 8 negative strand position 117,663,658 bp CTCTTACGGCATGTCTGGGA and ending after ACACATTCCCATCCACCCGC at 117,663,055 bp (GRCm38/mm10). This mutation deletes 604 bp of exon 3 and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 2 amino acids later. |
