|  Help  |  About  |  Contact Us

Allele : Gnb2<em1(IMPC)J> guanine nucleotide binding protein (G protein), beta 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5817218 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gnb2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Gnb2-8128J-M9422 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCATTCTTCAGTGCCCCA, ATGGGCAGAATGATAGTACA, TCCCATTCTTCAGTGCCCCA and ATGATGGGCAGTGCAAGAGA, which resulted in a 359 bp deletion beginning at Chromosome 5 negative strand position 137,530,468 bp, TTTCCCTCTCTTGCACTGCC, and ending after ATGGGCAGAATGATAGTACA at 137,530,110 bp (GRCm38/mm10). This mutation deletes all of exons 3 and 4 and 106 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp (AA) deletion 90 bp before the large deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 19 and early truncation 19 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gnb2<em1J>,
  • Gnb2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele