| Primary Identifier | MGI:5818701 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Chd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Chd3-8127J-F9396 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACCAGGCTAGAGAAAGTG, TTCTTTCTCTCAGATGGCGA, TGACCTCCATTCAGAACCAG and GTTCCTAGAGAGTGCCACGG, which resulted in a 343 bp deletion beginning at Chromosome 11 negative strand position 69,364,877 bp, ACGGTGGCAGTAAGAAGGGG, and ending after ACTTGGAACCCTAACCCCAC at 69,364,535 bp (GRCm38/mm10). This mutation deletes exon 2 and 230 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 2 amino acids later. |