| Primary Identifier | MGI:5818708 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Osbpl5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Osbpl5-8180J-F0511 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTCAAACTGCAGAGCCAGG, AGTGAGAGAGTCACACAAAT, GGTGGCCCCGAAGAGTGAGG and TCAGACCTCATCTAAGGCTA, which resulted in a 309 bp deletion beginning at Chromosome 7 negative strand position 143715937 bp, CTCACTCTTCGGGGCCACCT, and ending after GGATCTGGGGTCCTCCTGGC at 143,715,629 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 75 amino acids later. |
