| Primary Identifier | MGI:5819223 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Rad54l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a G>T Knockin at Chromosome 4 negative strand position 116,105,767 bp (GRCm38/mm10). This mutation changes the G nucleotide at c.1033G to a T at this position and is predicted to cause a change of amino acid sequence at residue p.G345C, mimicking the human p.G345C mutation. |
