| Primary Identifier | MGI:5819262 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fdx2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a 13 bp deletion (ATCATGGCCGCCT) beginning at Chromosome 9 negative strand position 21,073,509 bp, and ending after 21,073,497 bp (GRCm38/mm10). This mutation deletes the start of exon 1 and 3 bp of flanking intronic sequence including the splice acceptor and is predicted to be a null allele. |
