| Primary Identifier | MGI:5819264 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fdx2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TCCGGTCACGTGGCCTATCA, which resulted in a G>T Knock-in at Chromosome 9 negative strand position 21073504 (GRCm38/mm10). This mutation changes the G nucleotide to a T at this position and is predicted to cause a change of amino acid sequence at residue 1, mimicking the human p.M1T mutation. |
