| Primary Identifier | MGI:5819283 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nipsnap2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gbas-8294J-M2404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGCGCCGATTAAACAG, GACTGCCTCTACAACATACG, ATAACTCAAGGGCAGATACG and ATAACTCAAGGGCAGATACG, which resulted in a 365 bp deletion beginning at Chromosome 5 positive strand position 129,744,664 bp, GCTCCCCTGTTTAATCGGCG, and ending after AACTCAAGGGCAGATACGAG at 129,745,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a four bp deletion (GTAT) 68 bp before the 365 bp del that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 5 amino acids later. |
