|  Help  |  About  |  Contact Us

Allele : Rr505<em1Rlb> regulatory region 505; endonuclease-mediated mutation 1, Robin Lovell-Badge

Primary Identifier  MGI:5824333 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr505
Strain of Origin  (C57BL/6 x CBA)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  The core region (TESCO) of the TES regulatory region 10-13 kb upstream of the gene was targeted with a pair of single guide RNAs (sgRNAs) using the CRISPR/Cas9 system. The proximal sgRNA (equivalent to TCTGTTAACGTATGACACGA) was targeted to sequence 8 bp downstream of the 3'. The distal sgRNA (equivalent to GTTGGAGTTCCGATTTAGA) was targeted to sequence 41 bp downstream of the 5' end of the region (i.e. inside the region). Two stable lines were established that carried the exact 1260 bp deletion between the Cas9 cleavage sites. This 1260 bp deletion deletes 1252 of the 1293 bp TESCO sequence. One line also carried an 11 bp insertion of unrecognized sequence at the cleavage site. Only one of the lines was used for the experiments.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Sox9<em1Rlb>,
  • TESCO<->,
  • TESCO<->,
  • Sox9<em1Rlb>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele