| Primary Identifier | MGI:5823358 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4930447C04Rik |
| Strain of Origin | (C57BL/6J x CBA/J)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 124bp deletion (GRCm39:chr12:72963494-72963618) that includes part of exon 2, intron 2 and part of exon 3 was created by CRISPR/Cas9 genome editing using sgRNAs (targeting CACCGATCTGTTTGTCAGTTTGGAC, AAACGTCCAAACTGACAAACAGATC, CACCGTACTTATGTCTTGCTCATAC and AAACGTATGACAAGACATAAGTAC). Spermatocytes from homozygous mice showed no protein expression by immunofluorescence studies, suggesting that this is a null allele. |
