| Primary Identifier | MGI:5823412 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eef1b2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Eef1b2-8293J-M9257 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTGTTTTGCCTAGAAA, TTAACCTTTAGCACAATCCC, GCCACGCCAGGATCCATCCA and CAAGCATATTGAGAAGCCTG, which resulted in a 329 bp deletion beginning at Chromosome 1 positive strand position 63,178,315 bp, CTGGGATTGTGCTAAAGGTT, and ending after CTCCCTGGATGGATCCTGGC at 63,178,643 bp (GRCm38/mm10). This mutation deletes exon 3 and 202 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 34 amino acids later. |