| Primary Identifier | MGI:5823442 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dusp18 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dusp18-8276J-M2282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGACCGTGAACAATGGAA, GGTCTTTTCACACAGAGGAA, GAACTCCTCAGGCCGCAGAG and GCAAATCCCTAAAACAGGTA, which resulted in a 4631 bp deletion beginning at Chromosome 11 positive strand position 3,896,766 bp CATTGTTCACGGTCTCTCTG, and ending after AAGGGAACTCCTCAGGCCGC at 3,901,396 bp (GRCm38/mm10). This mutation deletes exon 2, which is the only translated exon, along with 277 bp of flanking intronic sequence, including the splice acceptor and donor, so it is predicted to result in a complete null. |
