|  Help  |  About  |  Contact Us

Allele : C7<em1(IMPC)J> complement component 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5823284 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project C7-8272J-M2250 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAACCAGAACAAAAACCGTG, TCTGAAAACACGGAAAGATA, GCACTTAAGTGTGGATTTGT and TAAATACTTGCACTTAAGTG, which resulted in a 247 bp deletion beginning at Chromosome 15 negative strand position 5,059,535 bp, AATCCACACTTAAGTGCAAG, and ending after TTAGATGTTTATGCACCTTAT at 5,059,289 bp (GRCm38/mm10). This mutation deletes exon 2 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 42 amino acids later. In addition there is a single bp deletion (G) in the intron 91 bases after the deletion that will not alter the results of the deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • C7<em1J>,
  • C7<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

8 Publication categories

Trail: Allele