| Primary Identifier | MGI:5825199 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Anapc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Anapc1-8258J-F6238 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATAATGTATCAAACTTC, GAGATAAATGCTTAAAATCA, AATAATCATCCACAAGCTAA and TTTCTGATGCCGTTAGCTTG, which resulted in a 221 bp deletion beginning at Chromosome 2 positive strand position 128,680,281 bp, GTTTGATACATTATGCAAAA, and ending after CGTCTAATAATCATCCACAA at 128680501 bp (GRCm38/mm10). This mutation deletes exon 4 and 169 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 125 and early truncation 4 amino acids later. |
