| Primary Identifier | MGI:5825297 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arl2bp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Arl2bp-8260J-M6258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATTGGTGAAACTGAGTGA, AAAACACTCGTGACGAAAAC, AATTGACCATAGGAACTAGA and TTACATATGTGATGGATCGT, which resulted in a 394 bp deletion beginning at Chromosome 8 positive strand position 94,667,392 bp, GTGAAACTGAGTGATGGGAG, and ending after TTTACATATGTGATGGATC at 94,667,785 bp (GRCm38/mm10). This mutation deletes exon 2 and 332 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 1 amino acid later. |