| Primary Identifier | MGI:5825309 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rtl10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gm16314-8293J-M2383 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGGCAGAAAACCCTAA, GCTCAACCATCACCTCTGAC, GGTTAGACCTCAACCAAGCA and GTGCTCAGAAGCCCTAGCAT, which resulted in a 942 bp deletion beginning at Chromosome 16 positive strand position 18,500,884 bp, GTCAGAGGTGATGGTTGAGC, and ending after TCCCTCCAAACCCTGCTTG at 18,501,825 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the translation start and stop and is predicted to result in a null mutation. |
