| Primary Identifier | MGI:5825313 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gramd2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gramd3-8350J-M0605 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCTTGCATAATCTCCGT, CTTTCTGCAGTTCATCACGA, GGTCAGCTGTGGAATCGAAT and TGCGACTCTATTATCGTGAG, which resulted in a 279 bp deletion beginning at Chromosome 18 positive strand position 56,474,000 bp GTGGGTTTTATTTCCCCAGG, and ending after ACTGTTCCTCCAGCCTATTC at 56,474,278 bp (GRCm38/mm10). This mutation deletes exon 3 and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. |
