|  Help  |  About  |  Contact Us

Allele : Tcn2<em1(IMPC)J> transcobalamin 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5827580 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tcn2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tcn2-8386J-M4720 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGATCCAAGTTATAAGAGAT, TATAACTTGGATCAAGTCAC, ATAGAGGGCATTTCTCCTGG and ATAGTTGCTTGCTAGTGGCA, which resulted in a 646 bp deletion beginning at Chromosome 11 negative strand position 3,927,730 bp GCATTTCTCCTGGCGGGCTG, and ending after CAGGCTGGATTCTAATTGGG at 3,927,085 bp (GRCm38/mm10). This mutation deletes exon 3 and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 41 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tcn2<em1J>,
  • Tcn2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele