| Primary Identifier | MGI:5827741 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gsto1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gsto1-8314J-F9698 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGAGGGCATCTGACCCA, AATCGGGCCACACTAATTCA, ACTCAGCGCTGCCTTTGTGA and AGCAGGAACAGAGCGTGCCA, which resulted in a deletion of 443 bp in total. This deletion begins at Chromosome 19 positive strand position 47,857,710 bp deleting 21 bp, CCCAGGGTCTTAACCTTCGGG, then retains 4 endogenous bp (TGCA) in the intron, then removes 422 bp ending after ACTCAGCGCTGCCTTTGTGA at 47,858,156 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 3 amino acids later. |
