|  Help  |  About  |  Contact Us

Allele : Lpgat1<em1(IMPC)J> lysophosphatidylglycerol acyltransferase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5829401 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lpgat1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Lpgat1-8352J-F7972 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACTTAGATGTTTACCAAC, ATTTTTCTAAGTTTGAAACT, CCTCGGGAGGATATCCTGCA and GTCTTAAAATTCCCTTCCTG, which resulted in a 585 bp deletion beginning at Chromosome 1 positive strand position 191,749,206 bp TGAATTCTTTCCCATGATAT, 15 bases later there is retention of 5 endogenous bp (TAAGT) in the intron, and ending after CAGGAAGGGAATTTTAAGAC at 191,749,795 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 48 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Lpgat1<em1J>,
  • Lpgat1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

7 Publication categories

Trail: Allele