| Primary Identifier | MGI:5896808 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ubiad1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ubiad1-8387J-M4740 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTAGGGAGAAGTGCCATA, ACTGTTCCCAAATTCATCAC, AGAATACCATGTCTGAAGAG and TCCGGGTACACAGAGATGAG, which resulted in a 2599 bp deletion beginning at Chromosome 4 negative strand position 148,436,873 bp, TCTCTGTGTACCCGGAGCTC, and ending after AGGACTTAGGGAGAAGTGCC at 148,434,275 bp (GRCm38/mm10). This mutation deletes exon 2 and 451 bp of flanking intronic sequence including the splice acceptor and is predicted to cause early truncation after amino acid residue 174. |