|  Help  |  About  |  Contact Us

Allele : Dusp15<em1(IMPC)J> dual specificity phosphatase-like 15; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5897441 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dusp15
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dusp15-8505J-0098M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTTGGTGAGCCTTGGGA, ACCAAGGTTGACCTTCGTGT, ACCAATAGAGAAGAGCTGCG and GTCTCAGGTAGAGATCAGGG, which resulted in a 553 bp deletion in total, beginning at Chromosome 2 negative strand position 152,950,921 bp, TGATCTCTACCTGAGACTTC, deleting 385 bp then retaining 4 endogenous bp (ACTT) in the intron, then removing 168 bp, and ending after AGGCTAAAGGCCCACACGAA at 152,950,365 bp (GRCm38/mm10). This mutation deletes exon 2 and 519 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 79 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele