| Primary Identifier | MGI:5898379 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aacs |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Aacs-8504J-0112F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGTCACGTGCCATGGACT, CTCTTCAGCCGAGCCTCAAA, TCCTCAAGCAACATTTCACT and ATTTCACTCGGAAACAATCA, which resulted in a 256 bp deletion beginning at Chromosome 5 positive strand position 125,482,732 bp, ATTTCACTCGGAAACAATCA, and ending after GGATGTCACGTGCCATGGAC at 125,482,987 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 51 amino acids later. |
