| Primary Identifier | MGI:5901846 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Phkb |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Phkb-8543J-8397M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATGCTCTAAGTAGTTGG, TGTGCAGTATGGATTTGCAG, GTTCTCCTGCTAACTCCACG and CTCGTCCACGTGGAGTTAGC, which resulted in a 329 bp deletion beginning at Chromosome 8 positive strand position 85,877,961 bp, ATTTGCAGTGGGCTAGAGTT, and ending after TGCTAACTCCACGTGGACGA at 85,878,289 bp (GRCm38/mm10). This mutation deletes exon 4 and 190 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 17 amino acids later. |
