|  Help  |  About  |  Contact Us

Allele : Larp1b<em1(IMPC)J> La ribonucleoprotein 1B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5901853 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Larp1b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Larp1b-8531J-915F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAACCTCCAGATCACACG, CAGTAGTCCTCTGACACGAT, ATATTTTCTCAATATCCTAG and AATGTCATTGCCTAATGAGA, which resulted in a 528 bp deletion beginning at Chromosome 3 positive strand position 40,970,239 bp GTGATCTGGAGGTTATATGC, and ending after AAATGTCATTGCCTAATGAG at 40,970,766 bp (GRCm38/mm10). In addition there is a 9 bp insertion (ATGAAAAAA) at the deletion site that will not alter the results of the exon deletion. This mutation deletes exon 7 and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 28 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories