|  Help  |  About  |  Contact Us

Allele : Hmg20a<em1(IMPC)J> high mobility group 20A; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5901855 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hmg20a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Hmg20a-8517J-1759F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTATGTAAGTTCAGCA, GAAGGTAGCATATAAAAGCC, GCCCTGCTGAACATTATAGG and ACTGCGGCTTCCAAAGCAAT, which resulted in a 788 bp deletion beginning at Chromosome 9 positive strand position 56,474,209 bp CTGGTCCATTACTAGGGTTT, and ending after GCTGTTTTGATATAGGGTCT at 56,474,996 bp (GRCm38/mm10). This mutation deletes exon 3 and 643 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 34 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele