| Primary Identifier | MGI:5911515 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdk18 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACAGCAGTAAATTTAGCA, CACCAGTTTGAGCCCCCCAG, CTAGCTGACATTGGGAAGAA and GACATGCCACTCAGTCTTGT, which resulted in a 226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000159061 (exon 3) and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 87 amino acids later. |
