|  Help  |  About  |  Contact Us

Allele : Cdk18<em1(IMPC)J> cyclin dependent kinase 18; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5911515 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdk18
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACAGCAGTAAATTTAGCA, CACCAGTTTGAGCCCCCCAG, CTAGCTGACATTGGGAAGAA and GACATGCCACTCAGTCTTGT, which resulted in a 226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000159061 (exon 3) and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 87 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele