|  Help  |  About  |  Contact Us

Allele : Yeats2<em1(IMPC)J> YEATS domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5910402 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Yeats2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCTGCTGATTTTAAATCAGT, CTGCATGAAACTGTAAGATA and GAGAACACTAAATTTATGGG, which resulted in a 176 bp deletion beginning at Chromosome 16 positive strand position 20,152,865 bp, and ending after 20,153,040 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279853 (exon 3) and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic deletion 48 bp after the 176 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele