| Primary Identifier | MGI:5910408 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lins1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAACACAGGATAGAAGTGA, ATACACCACACGCCACTCCA and CCTGAGGTGGTAATCCTTTG, which resulted in a disrupted deletion of 466 bp in total beginning at Chromosome 7 positive strand position 66,709,117 bp and deleting 197 bases then 3 endogenous bp (GGT) are retained, followed by an additional deletion of 269 bp ending at 66,709,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273824 (exon 5) and 327 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 1 amino acids later. |
