|  Help  |  About  |  Contact Us

Allele : Prim1<em1(IMPC)J> DNA primase, p49 subunit; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5911622 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prim1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAACTAAAACCTTAACTAAT, GGTTACATTATGCCCTAAAC, ACATTACCTTCAAAACTTGG and TTCTTGCCCCCAAGTTTTGA, which resulted in a 278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp and ending after 128,016,216 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205993 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp insertion (ATCTGA) at the deletion site and a 4 bp deletion (CTAA) 33 bp after the 278 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 21 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Prim1<->,
  • Prim1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele