|  Help  |  About  |  Contact Us

Allele : Rr56163<em1Mabm> regulatory region 56163; endonuclease-mediated mutation 1, Mark B Meyer

Primary Identifier  MGI:7790791 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr56163
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Cyp24a1 proximal promoter region was targeted using sgRNAs (equivalent to GGGGACCGACTGGCAAGGATGGG and CGCTTGCACAATCGCCACTCAGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the mutation of an AP1-binding site from GAGTCA to tttTgt, vitamin-D-response-element 1 (VDRE1) from AGGTGAGTGAGGGCG to ttcTGccTGtttGCG and VDRE2 from GGTTCAGCGGGTGCG to aaTTtAGCtaaccCG.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • C24-V1V2,
  • C24-V1V2
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele