| Primary Identifier | MGI:5910368 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph | Gene | Cracd |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTCTTAACATCCAGA, CATGTTGGTTAGGGAGGTGT, GGAACACCTCAGTTAGGAAC and CCCTTCAGTCTGGGTAGTAG, which resulted in a 3153 bp deletion beginning at Chromosome 5 positive strand position 76,856,248 bp and ending after 76,859,400 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000719827 (exon 6) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 15 amino acids later. In situ hybridization and qPCR confirmed reduced mRNA levels, indicating a hypomorphic allele. |