| Primary Identifier | MGI:5910464 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zhx1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences GAAGCGGAAGCTTTCTAAAT and AAAATCAACAACACCTTGCA, which resulted in a 2585 bp deletion beginning at Chromosome 15 negative strand position 58,054,823 bp and ending at 58,052,239 bp (GRCm38/mm10). This mutation deletes 2585 bp of ENSMUSE00000125822 (exon 3) coding sequence and is predicted to cause a change of amino acid sequence after residue 8 and early truncation 2 amino acids later. |
