| Primary Identifier | MGI:5910590 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep192 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGACTGGATAAGTATGT, GATTATTCTCTTTGGAGCTG, TGCTTCACTTACCAACAGCA and GCAGTGTTTTGGTTTGTCAC, which resulted in a 391 bp deletion beginning at Chromosome 18 positive strand position 67,807,133 bp and ending after 67,807,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332162 (exon 5) and 242 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (T) intronic deletion 69 bp before the 391 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 97 and early truncation 4 amino acids later. |
