| Primary Identifier | MGI:5905812 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sike1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sike1-8664J-4439M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGGGGTGGACGCTGCGGG, CTGATTTATCTTGGTCTGGA, GGGAGTGACCACATACCAAA and AGCAGAGTTGAATTGTTAGA, which resulted in a 572 bp deletion in total. This deletion begins at Chromosome 3 positive strand position 102,995,979 bp, GCCGAGCCGCGCCCAGGGGT, deleting 369 bp, then retains 4 endogenous bp (AGTG) in the intron, then removes 203 bp ending after ACCAAATGGAGGCTTCTATA at 102,996,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 470 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. |
