| Primary Identifier | MGI:5907253 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc85b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ccdc85b-8691J-5050M was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCCTCAGTCATCAGGGGAGC and GGAGGCCGAAGCAGGCGGCC, which resulted in a 680 bp deletion beginning at Chromosome 19 negative strand position 5,457,391 bp, GCCGAAGCAGGCGGCCTGGA, and ending after GCTGTGGACCTCCAGACCTG at 5,456,712 bp (GRCm38/mm10). This mutation deletes all of exon ENSMUSE00001034635 except the first 6 bp and an additional 77 bp of flanking intronic sequence and is predicted to cause early truncation after 2 amino acids. |
